circad | circRNAs associated with diseases

circ_0067934
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Non-Small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	29863250
Experimental Method
Sample Type	Tissue and cell lines	Comparison	159 paired NSCLC and adjacent normal tissues from NSCLC patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, J, Li, H (2018). CircRNA circ_0067934 silencing inhibits the proliferation, migration and invasion of NSCLC cells and correlates with unfavorable prognosis in NSCLC. Eur Rev Med Pharmacol Sci, 22, 10:3053-3060.